Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA-flag-mKdm4d-polyA
(Plasmid #61553)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61553 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA
  • Backbone size w/o insert (bp) 5700
  • Total vector size (bp) 7238
  • Modifications to backbone
    flag and polyA sequences were added to 5' and 3' side of insert, respectively.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Kdm4d
  • Alt name
    Jmjd2d
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1527
  • Entrez Gene
    Kdm4d (a.k.a. 4932416A15, Jmjd2d)
  • Promoter CMV and T7
  • Tag / Fusion Protein
    • flag (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cactgcttactggcttatcg
  • 3′ sequencing primer cgtttacaggttctttggtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-flag-mKdm4d-polyA was a gift from Yi Zhang (Addgene plasmid # 61553 ; http://n2t.net/addgene:61553 ; RRID:Addgene_61553)
  • For your References section:

    Embryonic Development following Somatic Cell Nuclear Transfer Impeded by Persisting Histone Methylation. Matoba S, Liu Y, Lu F, Iwabuchi KA, Shen L, Inoue A, Zhang Y. Cell. 2014 Nov 6;159(4):884-95. doi: 10.1016/j.cell.2014.09.055. Epub 2014 Oct 30. 10.1016/j.cell.2014.09.055 PubMed 25417163