Ai65(RCFL-tdT) targeting vector
(Plasmid #61577)

• Purpose: Target a Flp and Cre-dependent tdTomato expression cassette to the mouse Rosa26 locus
• Depositing Lab: Hongkui Zeng
• Publication: Madisen et al Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022.

Backbone

• Vector backbone: Rosa26 Targeting Vector
• Backbone size w/o insert (bp): 2881
• Total vector size (bp): 16295
• Vector type: Mouse Targeting, Cre/Lox
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl2
• Growth instructions: Grow in 15 microg/ml kanamycin
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pCAG-FSF-LSL-tdTomato
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sac1 (not destroyed)
• 3′ cloning site: Cla (not destroyed)
• 5′ sequencing primer: TCTTCGCTATTACGCCAGCT
• 3′ sequencing primer: AACAGCTATGACCATG

Resource Information

• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

NOTE: There are some minor discrepancies between the depositor's assembled sequence and Addgene's quality control sequence. The depositing lab has assessed these differences and states that they do no affect function.