Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Ai66(RCRL-tdT) targeting vector
(Plasmid #61578)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61578 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Rosa26 Targeting Vector
  • Backbone size w/o insert (bp) 2881
  • Total vector size (bp) 16291
  • Vector type
    Mouse Targeting, Cre/Lox
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CAG-RSR-LSL-tdTomato
  • Insert Size (bp)
    13410
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac1 (not destroyed)
  • 3′ cloning site Cla (not destroyed)
  • 5′ sequencing primer TCTTCGCTATTACGCCAGCT
  • 3′ sequencing primer AACAGCTATGACCATG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The Zeng lab recommends amplifying this plasmid in 15 microg/ml kanamycin to reduce recombination. Addgene is not able to supply the plasmid under these selection conditions and the stab you receive will be under Amp selection. We recommend using the low conc. Kan selection and checking your plasmid prep for recombination.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ai66(RCRL-tdT) targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 61578 ; http://n2t.net/addgene:61578 ; RRID:Addgene_61578)
  • For your References section:

    Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Madisen L, Garner AR, Shimaoka D, Chuong AS, Klapoetke NC, Li L, van der Bourg A, Niino Y, Egolf L, Monetti C, Gu H, Mills M, Cheng A, Tasic B, Nguyen TN, Sunkin SM, Benucci A, Nagy A, Miyawaki A, Helmchen F, Empson RM, Knopfel T, Boyden ES, Reid RC, Carandini M, Zeng H. Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022. 10.1016/j.neuron.2015.02.022 PubMed 25741722