Ai66(RCRL-tdT) targeting vector
(Plasmid #61578)

• Purpose: Target a Dre and Cre-dependent tdTomato expression cassette to the mouse Rosa26 locus
• Depositing Lab: Hongkui Zeng
• Publication: Madisen et al Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022.

Backbone

• Vector backbone: Rosa26 Targeting Vector
• Backbone size w/o insert (bp): 2881
• Total vector size (bp): 16291
• Vector type: Mouse Targeting, Cre/Lox
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl2
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CAG-RSR-LSL-tdTomato
• Insert Size (bp): 13410
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sac1 (not destroyed)
• 3′ cloning site: Cla (not destroyed)
• 5′ sequencing primer: TCTTCGCTATTACGCCAGCT
• 3′ sequencing primer: AACAGCTATGACCATG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Zeng lab recommends amplifying this plasmid in 15 microg/ml kanamycin to reduce recombination. Addgene is not able to supply the plasmid under these selection conditions and the stab you receive will be under Amp selection. We recommend using the low conc. Kan selection and checking your plasmid prep for recombination.