pLJM5-I560S-mDPYD
(Plasmid
#61615)
-
PurposeThe mouse Dpyd was used to rescue the human DPYD hairpin affect on EMT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61615 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLJM5
- Backbone size w/o insert (bp) 8001
- Total vector size (bp) 11079
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDihydropyrimidine dehydrogenase
-
Alt nameDpyd
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3086
-
MutationChanged Isoleucine at position 560 to Serine
-
Entrez GeneDpyd (a.k.a. AI315208, DPD, E330028L06Rik)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TGTACGGTGGGAGGTCTATATAAG
- 3′ sequencing primer CCCTTTTCTTTTAAAATTGTGGATGAATACTGCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThermo Scientific Biochem Sciences (Catalog Number: 4235971)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM5-I560S-mDPYD was a gift from David Sabatini (Addgene plasmid # 61615 ; http://n2t.net/addgene:61615 ; RRID:Addgene_61615) -
For your References section:
Dihydropyrimidine accumulation is required for the epithelial-mesenchymal transition. Shaul YD, Freinkman E, Comb WC, Cantor JR, Tam WL, Thiru P, Kim D, Kanarek N, Pacold ME, Chen WW, Bierie B, Possemato R, Reinhardt F, Weinberg RA, Yaffe MB, Sabatini DM. Cell. 2014 Aug 28;158(5):1094-109. doi: 10.1016/j.cell.2014.07.032. 10.1016/j.cell.2014.07.032 PubMed 25171410