Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLJM5-I560S-mDPYD
(Plasmid #61615)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61615 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLJM5
  • Backbone size w/o insert (bp) 8001
  • Total vector size (bp) 11079
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dihydropyrimidine dehydrogenase
  • Alt name
    Dpyd
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3086
  • Mutation
    Changed Isoleucine at position 560 to Serine
  • Entrez Gene
    Dpyd (a.k.a. AI315208, DPD, E330028L06Rik)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TGTACGGTGGGAGGTCTATATAAG
  • 3′ sequencing primer CCCTTTTCTTTTAAAATTGTGGATGAATACTGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Thermo Scientific Biochem Sciences (Catalog Number: 4235971)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM5-I560S-mDPYD was a gift from David Sabatini (Addgene plasmid # 61615 ; http://n2t.net/addgene:61615 ; RRID:Addgene_61615)
  • For your References section:

    Dihydropyrimidine accumulation is required for the epithelial-mesenchymal transition. Shaul YD, Freinkman E, Comb WC, Cantor JR, Tam WL, Thiru P, Kim D, Kanarek N, Pacold ME, Chen WW, Bierie B, Possemato R, Reinhardt F, Weinberg RA, Yaffe MB, Sabatini DM. Cell. 2014 Aug 28;158(5):1094-109. doi: 10.1016/j.cell.2014.07.032. 10.1016/j.cell.2014.07.032 PubMed 25171410