Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PRK5-FLAG-USP13/5-6
(Plasmid #61748)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61748 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRK5
  • Backbone size w/o insert (bp) 5204
  • Total vector size (bp) 7768
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    USP13/5-6 chimera
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2565
  • Mutation
    USP13 (1-721aa) fused to USP5 (717-859aa); D23Y in USP13-please see depositor comment below
  • GenBank ID
    NM_001098536.1 NM_003940.2
  • Entrez Gene
    USP5 (a.k.a. ISOT)
  • Entrez Gene
    USP13 (a.k.a. ISOT3, IsoT-3)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CTCTAGCATTTAGGTGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

mutation D23Y in USP13 does not affect plasmid function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PRK5-FLAG-USP13/5-6 was a gift from Yihong Ye (Addgene plasmid # 61748 ; http://n2t.net/addgene:61748 ; RRID:Addgene_61748)
  • For your References section:

    USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410