-
PurposeExpresses MS2 coat protein fused to GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLentiviral expression vector
- Backbone size w/o insert (bp) 4781
- Total vector size (bp) 7538
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMS2 coat protein fused to eGFP
-
SpeciesMS2 virus
-
Insert Size (bp)1188
- Promoter Ubc promoter
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCGGGCCCGCTCTAGATTGAAT
- 3′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MS2_GFP was a gift from Daniel Larson (Addgene plasmid # 61764 ; http://n2t.net/addgene:61764 ; RRID:Addgene_61764) -
For your References section:
Kinetic competition during the transcription cycle results in stochastic RNA processing. Coulon A, Ferguson ML, de Turris V, Palangat M, Chow CC, Larson DR. Elife. 2014 Oct 1;3. doi: 10.7554/eLife.03939. 10.7554/eLife.03939 PubMed 25271374