pCMV-Ubl4A K48R
(Plasmid #61809)

• Purpose: expresses mutated Ubl4A with K48R, with a C-terminal FLAG tag
• Depositing Lab: Yihong Ye
• Publication: Liu et al Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14.

Backbone

• Vector backbone: pCMV6-ENTRY
• Backbone manufacturer: Origene
• Backbone size w/o insert (bp): 4929
• Total vector size (bp): 5400
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: UBL4A
• Alt name: ubiquitin-like 4A,
• Alt name: GDX; G6PD; GET5; MDY2; UBL4; TMA24; DX254E; DXS254E
• Species: H. sapiens (human)
• Insert Size (bp): 471
• Mutation: K48R
• GenBank ID: NM_014235.4
• Entrez Gene: UBL4A (a.k.a. DX254E, DXS254E, G6PD, GDX, GET5, MDY2, TMA24, UBL4)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: sgfI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: GGACTTTCCAAAATGTCG
• 3′ sequencing primer: ATTAGGACAAGGCTGGTGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry