pcDNA 5/FR/TO-Ubl4A K48R
(Plasmid
#61811)
-
Purposeexpress C-terminal Ubl4A K48R, for making the stable cell line
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61811 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepc DNA 5/FR/TO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5070
- Total vector size (bp) 5661
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUBL4A
-
Alt nameubiquitin-like 4A,
-
Alt nameGDX; G6PD; GET5; MDY2; UBL4; TMA24; DX254E; DXS254E
-
SpeciesH. sapiens (human)
-
Insert Size (bp)591
-
MutationK48R
-
GenBank IDNM_014235.4
-
Entrez GeneUBL4A (a.k.a. DX254E, DXS254E, G6PD, GDX, GET5, MDY2, TMA24, UBL4)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA 5/FR/TO-Ubl4A K48R was a gift from Yihong Ye (Addgene plasmid # 61811 ; http://n2t.net/addgene:61811 ; RRID:Addgene_61811) -
For your References section:
USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410