MLM3636-Prnp-CDS-Pos
(Plasmid #61857)

• Purpose: Expresses a gRNA plasmid targeting the prion gene's exon 3, positive strand
• Depositing Lab: Gerold Schmitt-Ulms
• Publication: Mehrabian et al PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014.

Backbone

• Vector backbone: MLM3636
• Backbone manufacturer: Joung lab MLM3636
• Backbone size w/o insert (bp): 2278
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PrP guiding sequence
• Alt name: PrPC
• gRNA/shRNA sequence: GGTGGAACACCGGTGGAAGC
• Species: M. musculus (mouse)
• Entrez Gene: Prnp (a.k.a. CD230, PrP, PrP<C>, PrPC, PrPSc, Prn-i, Prn-p, Sinc, prP27-30, prP33-35C)
• Promoter: hU6 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: OS280 (5’-CAGGGTTATTGTCTCATGAGCGG-3’)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original plasmid was purchased from Addgene: MLM3636.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry