VARP GFP-pLXIN
(Plasmid #62950)

• Purpose: full length human VARP with C-terminal EGFP tag cloned into pLXIN
• Depositing Lab: Paul Luzio
• Publication: Hesketh et al Dev Cell. 2014 Jun 9;29(5):591-606. doi: 10.1016/j.devcel.2014.04.010. Epub 2014 May 22.

Backbone

• Vector backbone: pLXIN
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6100
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: VARP
• Alt name: ankyrin repeat domain 27 (VPS9 domain)
• Species: H. sapiens (human)
• Insert Size (bp): 3902
• Mutation: silent mutations of amino acids 422-428 to produce construct resistant to siRNA oligoVARP­1
• GenBank ID: NM_032139.2
• Entrez Gene: ANKRD27 (a.k.a. PP12899, VARP)
• Promoter: LTR
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: 5’ GTACACCCTAAGCCTCCGCC 3’
• 3′ sequencing primer: 5’ CCCTCACATTGCCAAAAGAC 3’

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

DNA sequences of amino acids 422-428:
WT CATGATAAAGATACCGTCCAA
Mutant CACGACAAGGACACTGTACAG

siRNA oligo is Dharmacon On-Target Plus oligonucleotide ANKRD27 siRNA. Catalogue number was as follows: (J‐014788­09).
In Hesketh et al. (2014) Dev Cell. 29: 591-606 it is called VARP­1