pLPhygCAS9
(Plasmid #63555)

• Purpose: Expresses CAS9 in Leishmania
• Depositing Lab: Greg Matlashewski
• Publication: Zhang et al MBio. 2015 Jul 21;6(4). pii: e00861-15. doi: 10.1128/mBio.00861-15.

Backbone

• Vector backbone: pLPHyg2
• Backbone size w/o insert (bp): 5747
• Total vector size (bp): 10112
• Vector type: Leishmania Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Humanized Streptococcus pyogenes Cas9 from PX330 (Addgene)
• Alt name: CAS9
• Species: Streptococcus pyogenes
• Tag / Fusion Protein:
  • flag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind III (not destroyed)
• 3′ cloning site: BamH I (not destroyed)
• 5′ sequencing primer: aagcttagcacctgcctgaaatcact

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The Humanized Streptococcus pyogenes Cas9 gene was derived from pX330 plasmid distributed by Addgene ( Dr Feng Zhang, Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry