3xFN-Tel-TAL/pMXs-neo
(Plasmid
#63591)
-
PurposeExpresses a 3xFLAG-tagged TAL protein recognizing a telomere repeat. A retroviral expression vector with the neomycin resistance gene.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs-neo
-
Backbone manufacturerHodaka Fujii
- Backbone size w/o insert (bp) 6271
- Total vector size (bp) 9064
-
Vector typeMammalian Expression, Retroviral, TALEN
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name3xFVN-Tel-TAL
-
Alt name3xFLAG-tag, V5-tag, NLS, Telomere-TAL
-
SpeciesSynthetic
-
Insert Size (bp)2793
- Promoter LTR
-
Tags
/ Fusion Proteins
- 3xFLAG-tag (N terminal on insert)
- V5-tag (N terminal on insert)
- nuclear localization signal (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR I (destroyed during cloning)
- 3′ cloning site EcoR I (destroyed during cloning)
- 5′ sequencing primer ggtggaccatcctctagact
- 3′ sequencing primer tggggactttccacaccctaactgacacacat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xFN-Tel-TAL/pMXs-neo was a gift from Hodaka Fujii (Addgene plasmid # 63591 ; http://n2t.net/addgene:63591 ; RRID:Addgene_63591) -
For your References section:
Identification of telomere-associated molecules by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP). Fujita T, Asano Y, Ohtsuka J, Takada Y, Saito K, Ohki R, Fujii H. Sci Rep. 2013 Nov 8;3:3171. doi: 10.1038/srep03171. 10.1038/srep03171 PubMed 24201379