This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #63709)


Item Catalog # Description Quantity Price (USD)
Plasmid 63709 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2241
  • Total vector size (bp) 7295
  • Vector type
    Just a donor DNA with Nanog homologous arm for knock-in sfGFP

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Nanog homologous arm, p2A, NLS, sfGFP, Nanog homologous arm
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Tag / Fusion Protein
    • sfGFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgttcttcggggcgaaaactctc
  • 3′ sequencing primer cacttctgagttcggcatgggg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pP2A_NLS_sfGFP was a gift from Stanley Qi (Addgene plasmid # 63709)
  • For your References section:

    Small Molecules Enhance CRISPR Genome Editing in Pluripotent Stem Cells. Yu C, Liu Y, Ma T, Liu K, Xu S, Zhang Y, Liu H, La Russa M, Xie M, Ding S, Qi LS. Cell Stem Cell. 2015 Feb 5;16(2):142-7. doi: 10.1016/j.stem.2015.01.003. 10.1016/j.stem.2015.01.003 PubMed 25658371