pLenti-Lifeact-tdTomato
(Plasmid #64048)

• Purpose: Fluorescent reporter for F-actin labeling in living cells
• Depositing Lab: Weiping Han
• Publication: Lim et al Nat Commun. 2015 Jan 9;6:5951. doi: 10.1038/ncomms6951.

Backbone

• Vector backbone: pLenti-hiko
• Backbone size w/o insert (bp): 9124
• Total vector size (bp): 10768
• Modifications to backbone: pLenti-hiko was digested with NheI + HpaI
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Lifeact
• Alt name: the first 17 amino acids of Abp140
• Species: S. cerevisiae (budding yeast), Synthetic
• Insert Size (bp): 51
• Promoter: Ubiquitin
• Tag / Fusion Protein:
  • tdTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: GGCGAGTGTGTTTTGTGAAG

Resource Information

• Supplemental Documents:
  • xDNA file for pLenti-Lifeact-tdTomato
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Lifeact sequence was initially reported in Riedl, J. et al. Lifeact: a versatile marker to visualize F-actin. Nat Methods 5, 605–607 (2008).

Please cite the following article as follows:
Lim, C.-Y. et al. Tropomodulin3 is a novel Akt2 effector regulating insulin-stimulated GLUT4 exocytosis through cortical actin remodeling. Nat Commun 6, 5951 (2015).