-
PurposeMyristoylated-FLAG-tagged Akt2, constitutively active
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti-hiko
- Backbone size w/o insert (bp) 9124
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAKT2
-
Alt namePKB beta
-
Alt namev-akt murine thymoma viral oncogene homolog 2
-
Alt nameRAC-BETA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1446
-
GenBank IDNM_001626.5
-
Entrez GeneAKT2 (a.k.a. HIHGHH, PKBB, PKBBETA, PRKBB, RAC-BETA)
- Promoter Ubiquitin
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- MYR (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer GGCGAGTGTGTTTTGTGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhuman AKT2 sequence was derived from Addgene #9016
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The MYR sequence was inserted in frame at EcoRI/NheI site into N terminal of pLenti-FLAG-hAkt2
Please cite the following article:
Lim, C.-Y. et al. Tropomodulin3 is a novel Akt2 effector regulating insulin-stimulated GLUT4 exocytosis through cortical actin remodeling. Nat Commun 6, 5951 (2015).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-FLAG-Akt2-CA was a gift from Weiping Han (Addgene plasmid # 64050 ; http://n2t.net/addgene:64050 ; RRID:Addgene_64050) -
For your References section:
Tropomodulin3 is a novel Akt2 effector regulating insulin-stimulated GLUT4 exocytosis through cortical actin remodeling. Lim CY, Bi X, Wu D, Kim JB, Gunning PW, Hong W, Han W. Nat Commun. 2015 Jan 9;6:5951. doi: 10.1038/ncomms6951. 10.1038/ncomms6951 PubMed 25575350