-
PurposeEGFP fused at the N-terminus of tubulin; lentiviral construct
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneL304
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametubulin
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer GGCGAGTGTGTTTTGTGAAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
L304-EGFP-Tubulin-WT was a gift from Weiping Han (Addgene plasmid # 64060 ; http://n2t.net/addgene:64060 ; RRID:Addgene_64060) -
For your References section:
Regulation of adipogenesis by cytoskeleton remodelling is facilitated by acetyltransferase MEC-17-dependent acetylation of alpha-tubulin. Yang W, Guo X, Thein S, Xu F, Sugii S, Baas PW, Radda GK, Han W. Biochem J. 2013 Feb 1;449(3):605-12. doi: 10.1042/BJ20121121. 10.1042/BJ20121121 PubMed 23126280