pGL3-Cp110-3'UTR
(Plasmid
#64083)
-
PurposeLuciferase assay
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64083 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Control
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5200
- Total vector size (bp) 6000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCcp110 (centriolar coiled coil protein 110)
-
Alt nameCp110
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)822
-
GenBank IDNM_182995
-
Entrez GeneCcp110 (a.k.a. 6330503K22Rik, AA415922, AI427129, AW557948, CP11, CP110, cep110)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site GGCCGGCC (unknown if destroyed)
- 3′ cloning site GGCCGGCC (unknown if destroyed)
- 5′ sequencing primer AAGGCCGGCCGAAGACAGCACTCACTGGGA
- 3′ sequencing primer GTGGCCGGCCTTCTCTGAGATCCGGATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Cp110-3'UTR was a gift from Lin He (Addgene plasmid # 64083 ; http://n2t.net/addgene:64083 ; RRID:Addgene_64083) -
For your References section:
miR-34/449 miRNAs are required for motile ciliogenesis by repressing cp110. Song R, Walentek P, Sponer N, Klimke A, Lee JS, Dixon G, Harland R, Wan Y, Lishko P, Lize M, Kessel M, He L. Nature. 2014 Jun 5;510(7503):115-20. doi: 10.1038/nature13413. 10.1038/nature13413 PubMed 24899310