This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL3-Cp110-3'UTR
(Plasmid #64083)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64083 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3-Control
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ccp110 (centriolar coiled coil protein 110)
  • Alt name
    Cp110
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    822
  • GenBank ID
    NM_182995
  • Entrez Gene
    Ccp110 (a.k.a. 6330503K22Rik, AA415922, AI427129, AW557948, CP110)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site GGCCGGCC (unknown if destroyed)
  • 3′ cloning site GGCCGGCC (unknown if destroyed)
  • 5′ sequencing primer AAGGCCGGCCGAAGACAGCACTCACTGGGA
  • 3′ sequencing primer GTGGCCGGCCTTCTCTGAGATCCGGATTGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Cp110-3'UTR was a gift from Lin He (Addgene plasmid # 64083 ; http://n2t.net/addgene:64083 ; RRID:Addgene_64083)
  • For your References section:

    miR-34/449 miRNAs are required for motile ciliogenesis by repressing cp110. Song R, Walentek P, Sponer N, Klimke A, Lee JS, Dixon G, Harland R, Wan Y, Lishko P, Lize M, Kessel M, He L. Nature. 2014 Jun 5;510(7503):115-20. doi: 10.1038/nature13413. 10.1038/nature13413 PubMed 24899310