Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

phage ubc nls ha pcp gfp
(Plasmid #64539)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64539 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE-UbiC
  • Total vector size (bp) 7385
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PCP
  • Alt name
    PP7 coat protein
  • Species
    bacteriophage
  • Promoter human ubiquitin C promoter
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • HA (N terminal on insert)
    • FactorXa site (N terminal on insert)
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer hUBCpro-F2 CGCCGATGATTATATAAGGA
  • 3′ sequencing primer EGFP-N
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phage ubc nls ha pcp gfp was a gift from Jeffrey Chao (Addgene plasmid # 64539 ; http://n2t.net/addgene:64539 ; RRID:Addgene_64539)
  • For your References section:

    Translation. An RNA biosensor for imaging the first round of translation from single cells to living animals. Halstead JM, Lionnet T, Wilbertz JH, Wippich F, Ephrussi A, Singer RH, Chao JA. Science. 2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380. 10.1126/science.aaa3380 PubMed 25792328