Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLVX-IRES-tdTomato-FlagAkt2W80A
(Plasmid #64834)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64834 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLVX-IRES-tdTomato
  • Backbone size w/o insert (bp) 8892
  • Total vector size (bp) 10407
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Akt2
  • Alt name
    PKBbeta, thymoma viral proto-oncogene 2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1515
  • Mutation
    Point mutation Trp 80 to Ala
  • GenBank ID
    NM_007434.3
  • Entrez Gene
    Akt2 (a.k.a. 2410016A19Rik, PKB, PKBbeta)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFlag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GACCTCCATAGAAGACACCGACT
  • 3′ sequencing primer GCCTTATTCCAAGCGGCTTCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-IRES-tdTomato-FlagAkt2W80A was a gift from Eva Gonzalez (Addgene plasmid # 64834 ; http://n2t.net/addgene:64834 ; RRID:Addgene_64834)
  • For your References section:

    Development of a new model system to dissect isoform specific Akt signaling in adipocytes. Kajno E, McGraw TE, Gonzalez E. Biochem J. 2015 Apr 9. 10.1042/BJ20150191 PubMed 25856301