-
Purposelentiviral expression of human POLQ -DY2230AA mutant (a polymerase domain mutant)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDH-EF1-FHC
-
Backbone manufacturerWood Lab, Addgene plasmid 64874
- Total vector size (bp) 15236
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePOLQ
-
SpeciesH. sapiens (human)
-
MutationD2330A,Y2331A, in the DNA polymerase domain (POL); mutation of the corresponding residues in other DNA polymerases completely inactivates polymerase activity
-
Entrez GenePOLQ (a.k.a. PRO0327)
- Promoter EF1alpha
-
Tags
/ Fusion Proteins
- FLAG (C terminal on backbone)
- HA (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer EF1a-F_alt (gccgtgaacgttctttttc)
- 3′ sequencing primer IRES-R (CCTCACATTGCCAAAAGACG) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's quality control sequencing did not confirm mutations in this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-EF1-FHC-POLQ-DY2230AA was a gift from Richard Wood (Addgene plasmid # 64878 ; http://n2t.net/addgene:64878 ; RRID:Addgene_64878) -
For your References section:
Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. Yousefzadeh MJ, Wyatt DW, Takata K, Mu Y, Hensley SC, Tomida J, Bylund GO, Doublie S, Johansson E, Ramsden DA, McBride KM, Wood RD. PLoS Genet. 2014 Oct 2;10(10):e1004654. doi: 10.1371/journal.pgen.1004654. eCollection 2014 Oct. PGENETICS-D-14-01461 [pii] PubMed 25275444