-
PurposeInducible expression of murine CDS encoding for NfiA. Toghther with TetO-FUW-Sox9 and TetO-FUW-NfiB allows reprograming into iAstro. cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTetO-FUW
- Backbone size w/o insert (bp) 8421
- Total vector size (bp) 9971
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNfia
-
Alt nameCtf
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1558
-
GenBank ID18027
-
Entrez GeneNfia (a.k.a. 1110047K16Rik, 9430022M17Rik, CTF, NF1-A, NF1A)
- Promoter TetO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hpa (destroyed during cloning)
- 3′ cloning site Nhe (not destroyed)
- 5′ sequencing primer GCAGAGCTCGTTTAGTGAACCGTC
- 3′ sequencing primer AGCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNfiA coding was kindly Provided by Dr G. Messina
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TetO-FUW-NfiA was a gift from Vania Broccoli (Addgene plasmid # 64901 ; http://n2t.net/addgene:64901 ; RRID:Addgene_64901) -
For your References section:
Direct conversion of fibroblasts into functional astrocytes by defined transcription factors. Caiazzo M, Giannelli S, Valente P, Lignani G, Carissimo A, Sessa A, Colasante G, Bartolomeo R, Massimino L, Ferroni S, Settembre C, Benfenati F, Broccoli V. Stem Cell Reports. 2015 Jan 13;4(1):25-36. doi: 10.1016/j.stemcr.2014.12.002. Epub 2014 Dec 31. 10.1016/j.stemcr.2014.12.002 PubMed 25556566