pcDNA3-HA-ERK5 713
(Plasmid #65246)

• Purpose: Expression of HA tagged ERK5 AA 2-713 in mammalian cells
• Depositing Lab: Axel Ullrich
• Publication: Buschbeck et al J Biol Chem. 2002 Aug 16;277(33):29503-9. Epub 2002 May 31.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5446
• Total vector size (bp): 7546
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ERK5 713
• Alt name: MAPK7 713
• Species: H. sapiens (human)
• Insert Size (bp): 2100
• Mutation: deleted AA 714-817
• GenBank ID: NM_139033
• Entrez Gene: MAPK7 (a.k.a. BMK1, ERK4, ERK5, PRKM7)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CACTGCTTACTGGCTTATCG
• 3′ sequencing primer: TGGCAACTAGAAGGCACAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert codes for ERK5 AA 2-713 Note: Amino acid number may be off when compared to current NCBI entry. Please check QC sequence to verify end of coding region.