pLXSN-FLK1 TM
(Plasmid #65249)

• Purpose: Expression of dominant negative FLK1 in mammalian cells
• Depositing Lab: Axel Ullrich
• Publication: Millauer et al Nature. 1994 Feb 10;367(6463):576-9.

Backbone

• Vector backbone: pLXSN
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 5900
• Total vector size (bp): 8300
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: FLK1 TM
• Alt name: VEGFR2 TM; KDR TM
• Species: M. musculus (mouse)
• Insert Size (bp): 2400
• Mutation: deleted AA 786-1346
• GenBank ID: NM_010612
• Entrez Gene: Kdr (a.k.a. 6130401C07, Flk-1, Flk1, Krd-1, Ly73, VEGFR-2, VEGFR2, orv, sVEGFR-2)
• Promoter: LTR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HpaI (destroyed during cloning)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: CTCTCCCCCTTGAACCTC
• 3′ sequencing primer: GACTTTCCACACCCTAACTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert codes for extracellular and transmembrane domains of FLK1. Note: Amino acid number may be off when compared to current NCBI entry. Please check QC sequence to verify end of coding region.