pFBGR
(Plasmid
#65422)
-
PurposeProvides cis-acting sequences for rAAV transgene packaging and transposase-mediated recombinant baculovirus construction.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFBHTb
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4554
- Total vector size (bp) 7240
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameenhanced green fluorescent protein
-
Alt nameeGFP
-
Insert Size (bp)750
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Eco105I (destroyed during cloning)
- 3′ cloning site Ecl136II (destroyed during cloning)
- 5′ sequencing primer GACTCACTATAGGGGAATTG
- 3′ sequencing primer GATCCAGACATGATAAGATAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFBGR was a gift from Robert Kotin (Addgene plasmid # 65422) -
For your References section:
Insect cells as a factory to produce adeno-associated virus type 2 vectors. Urabe M, Ding C, Kotin RM. Hum Gene Ther. 2002 Nov 1;13(16):1935-43. 10.1089/10430340260355347 PubMed 12427305