Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pKS011
(Plasmid #65464)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65464 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSC101
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MBP-Ntag-mCherry
  • Insert Size (bp)
    2270
  • Promoter pl-TetO
  • Tags / Fusion Proteins
    • MBP
    • FLAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCGTATCACGAGGCCCTTTC
  • 3′ sequencing primer GGATAACAGAAAGGCCGGGAAATAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKS011 was a gift from Keith Tyo (Addgene plasmid # 65464 ; http://n2t.net/addgene:65464 ; RRID:Addgene_65464)
  • For your References section:

    N-Terminal-Based Targeted, Inducible Protein Degradation in Escherichia coli. Sekar K, Gentile AM, Bostick JW, Tyo KE. PLoS One. 2016 Feb 22;11(2):e0149746. doi: 10.1371/journal.pone.0149746. eCollection 2016. PONE-D-15-42990 [pii] PubMed 26900850