pTre-Tight-luciferase-Hottip (522)
(Plasmid
#65490)
-
Purposepositive control for lncRNA expression assay
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65490 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTre-tight-SV40-luciferase
-
Backbone manufacturerGuigo lab, Addgene plasmid 65489
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHottip
-
SpeciesH. sapiens (human)
-
Insert Size (bp)718
-
Entrez GeneHOTTIP (a.k.a. HOXA-AS6, HOXA13-AS1, NCRNA00213)
- Promoter tight TRE promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer C328F AGGCGTATCACGAGGCCCTTTCGT
- 3′ sequencing primer C328R TATTACCGCCTTTGAGTGAGCTGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTre-Tight-luciferase-Hottip (522) was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 65490 ; http://n2t.net/addgene:65490 ; RRID:Addgene_65490)