pTre-Tight-luciferase-GFP (467)
(Plasmid #65491)

• Purpose: negative control for expression assays
• Depositing Labs: Roderic Guigo, Rory Johnson
• Publication: pTREtight reporter plasmids--Roderic Guigo (unpublished)

Backbone

• Vector backbone: pTre-tight-SV40-luciferase
• Backbone manufacturer: Guigo lab, Addgene plasmid 65489
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: EGFP
• Insert Size (bp): 734
• Promoter: tight TRE promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: C328F AGGCGTATCACGAGGCCCTTTCGT
• 3′ sequencing primer: C328R TATTACCGCCTTTGAGTGAGCTGA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Compared to the provided full plasmid sequence, Addgene's quality control sequencing finds an L27F amino acid residue substitution in the EGFP fluorophore. The depositing laboratory is aware of this residue change, and it does not affect fluorophore function.