pWY82
(Plasmid #65721)

• Purpose: Plasmid with 2.5 kb of telomere sequence
• Depositing Lab: James Birchler
• Publication: Yu et al Proc Natl Acad Sci U S A. 2006 Nov 14;103(46):17331-6. Epub 2006 Nov 3.

Backbone

• Vector backbone: pTF101.1
• Backbone size w/o insert (bp): 9189
• Total vector size (bp): 11656
• Vector type: Plant Expression
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin and Streptomycin, 50 & 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl2
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Telomere
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 2500

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI,EcoRI (not destroyed)
• 3′ cloning site: NcoI,EcoRV (not destroyed)
• 5′ sequencing primer: gggcgacgtcgactgttta
• 3′ sequencing primer: TCACACAGGAAACAGCTATGAC

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene was unable to sequence this plasmid due to the repetitive nature of the telomere repeats. The plasmid was instead verified by restriction digest. The gel image is provided on this page under- Resource Information- Addgene Notes.