pcDNA3.1-V5-hTEV
(Plasmid #65800)

• Purpose: expresses human codon-optimised TEV protease
• Depositing Lab: Douglas Green
• Publication: Oberst et al J Biol Chem. 2010 May 28;285(22):16632-42. doi: 10.1074/jbc.M109.095083. Epub 2010 Mar 22.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5523
• Total vector size (bp): 6280
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: V5-human TEV
• Species: Synthetic
• Mutation: codon-optimised to express in mammalian cells
• Promoter: CMV
• Tag / Fusion Protein:
  • V5 (N terminal on insert)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: tagaaggcacagtcgagg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: custom synthesized by BioNexus
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry