Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #65953)


Item Catalog # Description Quantity Price (USD)
Plasmid 65953 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
    Bacillus thuringiensis
  • Insert Size (bp)
  • Promoter pCin*
  • Tag / Fusion Protein
    • LAA tagged (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer gagaaaactagtatgacagtaaagaaactttatttcatcccagcag
  • 3′ sequencing primer ggaccagagctcttattacgctgcaagggcgtaattttcgtcgttcgctgc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter pCin
  • Tag / Fusion Protein
    • LAA tagged (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer gagaaaactagtatgaaaccagtaacgttatacgatgtcgcag
  • 3′ sequencing primer taggggaagcttttattacgctgcaagggcgtaattttcgtcgttcgctgc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC239 was a gift from Matthew Bennett (Addgene plasmid # 65953 ; ; RRID:Addgene_65953)
  • For your References section:

    SYNTHETIC BIOLOGY. Emergent genetic oscillations in a synthetic microbial consortium. Chen Y, Kim JK, Hirning AJ, Josic K, Bennett MR. Science. 2015 Aug 28;349(6251):986-9. doi: 10.1126/science.aaa3794. 10.1126/science.aaa3794 PubMed 26315440