Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p(bhsp68-Cas9)
(Plasmid #65959)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65959 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSLfa[Tc-bhsp68::nlsEGFP]fa
  • Backbone size w/o insert (bp) 4168
  • Total vector size (bp) 8323
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4155
  • Promoter bhsp
  • Tag / Fusion Protein
    • nuclear localization sequence (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site Not1 (unknown if destroyed)
  • 5′ sequencing primer TAACCGGTCGCCACCATGGATAAGAAATAC
  • 3′ sequencing primer AAGCGGCCGCTCATCCTGCAGCTCCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cas9 was cloned from Addgene MLM3613
  • Terms and Licenses

Depositor Comments

An online tool to help oligo design for gRNAs is at http://www.averof-lab.org/tools/Tribolium_CRISPR.php

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p(bhsp68-Cas9) was a gift from Michalis Averof (Addgene plasmid # 65959 ; http://n2t.net/addgene:65959 ; RRID:Addgene_65959)
  • For your References section:

    Efficient CRISPR-mediated gene targeting and transgene replacement in the beetle Tribolium castaneum. Gilles AF, Schinko JB, Averof M. Development. 2015 Jul 9. pii: dev.125054. 10.1242/dev.125054 PubMed 26160901