pmCTIP2-N106
(Plasmid #66808)

• Purpose: 2nd generation lentiviral transfer plasmid. Expresses mouse CTIP2 with blasticidin resistance
• Depositing Lab: Andrew Yoo
• Publication: Richner et al Nat Protoc. 2015 Oct;10(10):1543-55. doi: 10.1038/nprot.2015.102. Epub 2015 Sep 17.

Backbone

• Vector backbone: N106
• Backbone manufacturer: Homemade
• Backbone size w/o insert (bp): 8465
• Total vector size (bp): 10904
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CTIP2 isoform b
• Alt name: CTIP2
• Alt name: BCL11B
• Species: M. musculus (mouse)
• Insert Size (bp): 3631
• GenBank ID: NM_021399.2 NP_067374.2
• Entrez Gene: Bcl11b (a.k.a. 9130430L19Rik, B630002E05Rik, BCL-11B, Ctip2, Rit1)
• Promoter: Human EF1a

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGCACTTGATGTAATTCTCCTTG
• 3′ sequencing primer: GTGGATGTGGAATGTGTGCGA

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry