Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

OCT4-2A-mOrange
(Plasmid #66986)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 66986 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    OCT4-2A-eGFP-PGKPuro plasmid (Addgene: 31938)
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 5424
  • Total vector size (bp) 6135

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    2A-mOrange
  • Insert Size (bp)
    711

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (unknown if destroyed)
  • 3′ cloning site Asc1 (unknown if destroyed)
  • 5′ sequencing primer CTCACTTCACTGCACTGTACTCCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    OCT4-2A-mOrange was a gift from Danwei Huangfu (Addgene plasmid # 66986 ; http://n2t.net/addgene:66986 ; RRID:Addgene_66986)
  • For your References section:

    A CRISPR/Cas-Mediated Selection-free Knockin Strategy in Human Embryonic Stem Cells. Zhu Z, Verma N, Gonzalez F, Shi ZD, Huangfu D. Stem Cell Reports. 2015 May 28. pii: S2213-6711(15)00128-9. doi: 10.1016/j.stemcr.2015.04.016. 10.1016/j.stemcr.2015.04.016 PubMed 26028531