pMXsIP GFP-VPS33A
(Plasmid #67022)

• Purpose: human VPS33A ORF was inserted into pMXsIP SPGFP-GS Ci2 vector
• Depositing Lab: Noboru Mizushima
• Publication: Jiang et al Mol Biol Cell. 2014 Apr;25(8):1327-37. doi: 10.1091/mbc.E13-08-0447. Epub 2014 Feb 19.

Backbone

• Vector backbone: pMXs-IP
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 5847
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Vacuolar protein sorting 33 homolog A (S. cerevisiae) (VPS33A)
• Species: H. sapiens (human)
• Entrez Gene: VPS33A (a.k.a. MPSPS)
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGACCACTACCAGCAGAACA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The P21R mutation in VPS33A has no functional consequence.