Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

miR-141 reporter
(Plasmid #67632)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 67632 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    2 binding sites for miR-141
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCTGAAGAACGAGCAGTAAT
  • 3′ sequencing primer GTCAGACAAACCCTAACCAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    miR-141 reporter was a gift from Judy Lieberman (Addgene plasmid # 67632 ; ; RRID:Addgene_67632)
  • For your References section:

    miR-200-containing extracellular vesicles promote breast cancer cell metastasis. Le MT, Hamar P, Guo C, Basar E, Perdigao-Henriques R, Balaj L, Lieberman J. J Clin Invest. 2014 Dec;124(12):5109-28. doi: 10.1172/JCI75695. Epub 2014 Nov 17. 10.1172/JCI75695 PubMed 25401471