Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

DdMCU
(Plasmid #67642)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67642 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pACT2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8100
  • Total vector size (bp) 9000
  • Modifications to backbone
    none
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DdMCU
  • Species
    Dictyostelium discoideum
  • Insert Size (bp)
    900
  • Promoter ADH1
  • Tag / Fusion Protein
    • Flag tag with linker (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GACAAGCTGTGACCGTCTCC
  • 3′ sequencing primer GTTTACGTCCGCTAGCTTGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DdMCU was a gift from Vamsi Mootha (Addgene plasmid # 67642 ; http://n2t.net/addgene:67642 ; RRID:Addgene_67642)
  • For your References section:

    Reconstitution of the mitochondrial calcium uniporter in yeast. Kovacs-Bogdan E, Sancak Y, Kamer KJ, Plovanich M, Jambhekar A, Huber RJ, Myre MA, Blower MD, Mootha VK. Proc Natl Acad Sci U S A. 2014 Jun 17;111(24):8985-90. doi: 10.1073/pnas.1400514111. Epub 2014 Jun 2. 10.1073/pnas.1400514111 PubMed 24889638