Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #67835)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 67835 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4076
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Entrez Gene
    KLF1 (a.k.a. EKLF, EKLF/KLF1)
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer SV40pro-F2 (CCCCATGGCTGACTAATTTTT)
  • 3′ sequencing primer SV40 poly A Reverse
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Full-length human EKLF cDNA was generated from bone marrow total RNA. This was used for activation studies.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSG5-hEKLF was a gift from James Bieker (Addgene plasmid # 67835 ; ; RRID:Addgene_67835)
  • For your References section:

    Structural and functional characterization of an atypical activation domain in erythroid Kruppel-like factor (EKLF). Mas C, Lussier-Price M, Soni S, Morse T, Arseneault G, Di Lello P, Lafrance-Vanasse J, Bieker JJ, Omichinski JG. Proc Natl Acad Sci U S A. 2011 Jun 28;108(26):10484-9. doi: 10.1073/pnas.1017029108. Epub 2011 Jun 13. 10.1073/pnas.1017029108 PubMed 21670263