pGEX-2TK-GST-mEKLF
(Plasmid #67836)

• Purpose: Encodes GST fusion to murine EKLF (nucleotides 71-1215)
• Depositing Lab: James Bieker
• Publication: Zhang et al Proc Natl Acad Sci U S A. 1998 Aug 18;95(17):9855-60.

Backbone

• Vector backbone: pGEX-2TK
• Backbone manufacturer: GE Healthcare Life Sciences
• Backbone size w/o insert (bp): 4969
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: EKLF
• Species: M. musculus (mouse)
• Mutation: Full-length mEKLF is aa 20-376; amino acid 19 is the initiator Methionine; See depositor comments below on mutations G299S, T305S
• Entrez Gene: Klf1 (a.k.a. Eklf, Nan)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: pGEX5
• 3′ sequencing primer: AmpR (ATAATACCGCGCCACATAGC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutations G299S, and T305S have no functional consequences.