This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSG5-FLAG-mEKLF Zinc Fingers
(Plasmid #67837)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 67837 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4076
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Mutation
    Zinc Fingers are amino acids 287-end; this numbering is based on amino acid 19 as the initiator Methionine; See depositor comments below on mutations G299S, T305S
  • Entrez Gene
    Klf1 (a.k.a. Eklf, Nan)
  • Promoter SV40
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site StuI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer SV40pro-F2 (CCCCATGGCTGACTAATTTTT)
  • 3′ sequencing primer SV40 poly A Reverse
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Mutations G299S, T305S have no functional consequences.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSG5-FLAG-mEKLF Zinc Fingers was a gift from James Bieker (Addgene plasmid # 67837 ; ; RRID:Addgene_67837)
  • For your References section:

    Unanticipated repression function linked to erythroid Kruppel-like factor. Chen X, Bieker JJ. Mol Cell Biol. 2001 May;21(9):3118-25. 10.1128/MCB.21.9.3118-3125.2001 PubMed 11287616