This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA4_ChR2opt_mKATE
(Plasmid #67958)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67958 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA4/TO
  • Backbone manufacturer
    Invitrogen (TRex Kit)
  • Backbone size w/o insert (bp) 5078
  • Total vector size (bp) 6833
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Channelrhodopsin 2 opt
  • Alt name
    ChR2opt
  • Species
    C. reinhardtii
  • Insert Size (bp)
    1761
  • Mutation
    synthetically produced for mammalian optimized coding; H134R *(see below)
  • Promoter CMV -TetON
  • Tag / Fusion Protein
    • mKatushka (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CMVfor; CGAATTTAAAAACCCCAGCA; GTCCAAGGGCGAGGAACT
  • 3′ sequencing primer TGCTGTAGTCGTTGCTCAGG; CCTTCCACCACCTTGATCT; GATGGCTGGCAACTAGAAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

*Note: This plasmid contains a standard, published H134R variant of Channelrhodopsin 2 that is reported to increase the currents achieved by the channel (see Nagel et al. 2005).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA4_ChR2opt_mKATE was a gift from Andreas Offenhäusser (Addgene plasmid # 67958)