Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA4_ChR2opt_mKATE
(Plasmid #67958)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67958 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA4/TO
  • Backbone manufacturer
    Invitrogen (TRex Kit)
  • Backbone size w/o insert (bp) 5078
  • Total vector size (bp) 6833
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Channelrhodopsin 2 opt
  • Alt name
    ChR2opt
  • Species
    C. reinhardtii
  • Insert Size (bp)
    1761
  • Mutation
    synthetically produced for mammalian optimized coding; H134R *(see below)
  • Promoter CMV -TetON
  • Tag / Fusion Protein
    • mKatushka (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CMVfor; CGAATTTAAAAACCCCAGCA; GTCCAAGGGCGAGGAACT
  • 3′ sequencing primer TGCTGTAGTCGTTGCTCAGG; CCTTCCACCACCTTGATCT; GATGGCTGGCAACTAGAAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was synthetically produced by GeneArt and supplied in pcDNA4/TO from Invitrogen
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

*Note: This plasmid contains a standard, published H134R variant of Channelrhodopsin 2 that is reported to increase the currents achieved by the channel (see Nagel et al. 2005).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA4_ChR2opt_mKATE was a gift from Andreas Offenhäusser (Addgene plasmid # 67958 ; http://n2t.net/addgene:67958 ; RRID:Addgene_67958)