pJaM
(Plasmid
#67966)
-
PurposeInducible TraJ, TraM expression with arabinose.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67966 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSB3C5
-
Backbone manufacturerRegistry of Standard Parts
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTraM, TraJ
-
SpeciesE. coli
- Promoter pBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer attcagcaatttgcccgtgc
- 3′ sequencing primer atctgattaccgcctttgag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJaM was a gift from Joshua Leonard (Addgene plasmid # 67966 ; http://n2t.net/addgene:67966 ; RRID:Addgene_67966)