pLNKR2
(Plasmid
#67969)
-
PurposeHigh copy number plasmid encoding part of the tra Operon traC-artA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSB1A3
-
Backbone manufacturerRegistry of Standard Parts
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametra Operon (second Quarter)
-
SpeciesE. coli
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer gtgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagct (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLNKR2 was a gift from Joshua Leonard (Addgene plasmid # 67969 ; http://n2t.net/addgene:67969 ; RRID:Addgene_67969)