Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKLV2-EF1a-BsdCas9-W
(Plasmid #67978)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67978 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKLV2 lentiviral vector
  • Backbone size w/o insert (bp) 5783
  • Total vector size (bp) 12704
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EF1a-Cas9 cassette, WPRE
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    6964
  • Promoter EF1a
  • Tag / Fusion Protein
    • Cas9 fused with Flag-tag and a NLS at the N terminus and another NLS at the C terminus

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CATAATAGCAACAGACATAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-EF1a-BsdCas9-W was a gift from Kosuke Yusa (Addgene plasmid # 67978 ; http://n2t.net/addgene:67978 ; RRID:Addgene_67978)
  • For your References section:

    A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Tzelepis K, Koike-Yusa H, De Braekeleer E, Li Y, Metzakopian E, Dovey OM, Mupo A, Grinkevich V, Li M, Mazan M, Gozdecka M, Ohnishi S, Cooper J, Patel M, McKerrell T, Chen B, Domingues AF, Gallipoli P, Teichmann S, Ponstingl H, McDermott U, Saez-Rodriguez J, Huntly BJ, Iorio F, Pina C, Vassiliou GS, Yusa K. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. 10.1016/j.celrep.2016.09.079 PubMed 27760321