-
Purposeexpress Fis1 tail-anchored FRB for heterodimerization with FKBP in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68056 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepC4-RhE (now pHet-1)
-
Backbone manufacturerARIAD (now Clontech)
- Backbone size w/o insert (bp) 5329
- Total vector size (bp) 5473
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFis1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)183
-
MutationFis1 tail (aa 93-152)
-
Entrez GeneFIS1 (a.k.a. CGI-135, TTC11)
-
Tag
/ Fusion Protein
- FRB (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMVf: CGC AAA TGG GCG GTA GGC GTG
- 3′ sequencing primer Bglob-intron-R: TTTGCCCCCTCCATATAACA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC4-RhE-FRB-Fis1 was a gift from Richard Youle (Addgene plasmid # 68056 ; http://n2t.net/addgene:68056 ; RRID:Addgene_68056) -
For your References section:
p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not mitophagy; VDAC1 is dispensable for both. Narendra D, Kane LA, Hauser DN, Fearnley IM, Youle RJ. Autophagy. 2010 Nov;6(8):1090-106. 13426 [pii] PubMed 20890124