This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p426-SNR52p-gRNA.csr-1.Y-SUP4t
(Plasmid #68060)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68060 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS426
  • Total vector size (bp) 6274
  • Vector type
    Yeast Expression, CRISPR ; N. crassa, Fungi
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA for csr-1 locus
  • Alt name
    gRNA
  • Alt name
    csr-1
  • gRNA/shRNA sequence
    GAGTGGGAGGGTCCCGTCCT
  • Species
    N. crassa, S.pyogenes, other fungi
  • Promoter SNR52

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGAGCTTCTTTGAAAAGATAATGTATG
  • 3′ sequencing primer GTTACATGCGTACACGCGTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    p426-SNR52p-gRNA.CAN1.Y-SUP4t (Plasmid #43803)
  • Terms and Licenses

Depositor Comments

The target sequence to csr-1 locus was added instead of CAN1 of p426-SNR52p-gRNA.CAN1.Y-SUP4t (Plasmid #43803) from Dr. Church lab.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p426-SNR52p-gRNA.csr-1.Y-SUP4t was a gift from Christian Hong (Addgene plasmid # 68060)
  • For your References section:

    Efficient gene editing in Neurospora crassa with CRISPR technology. Matsu-ura Toru, Baek Mokryun, Kwon Jungin and Hong Christian. Fungal Biology and Biotechnology 2015, 2:4 10.1186/s40694-015-0015-1