3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
(Plasmid
#68405)
-
PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAmp
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 7648
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert name3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
-
Alt namegRNAs target PTEN exon 5, p53 exon 8, SMAD4 exon 2
-
SpeciesSynthetic
-
Insert Size (bp)1059
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NruI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer ttttggcaagtcagttaggaca
- 3′ sequencing primer GGAATGGTAGATGTTTAAAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFlpO
-
SpeciesSynthetic
-
Insert Size (bp)1300
- Promoter Synthetic Probasin ARRx2
-
Tag
/ Fusion Protein
- mTurquoise2 (BFP) (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site PacI (unknown if destroyed)
- 5′ sequencing primer GGAATGGTAGATGTTTAAAC
- 3′ sequencing primer aagtcgtgctgcttcatgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 68405 ; http://n2t.net/addgene:68405 ; RRID:Addgene_68405)