pU6_(GLuc)_sgRNA
(Plasmid
#68422)
-
PurposeTransient expression of a minimal sgRNA targeting the GLuc reporter, in mammalian cells. U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNEB193
-
Backbone manufacturerNEB
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGluc sgRNA
-
gRNA/shRNA sequencegRNA: GATCTAGATACGACTCACTAT
-
SpeciesSynthetic
- Promoter human U6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer LKO.1 5
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Minimal sgRNA, targeting the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6_(GLuc)_sgRNA was a gift from John Rinn (Addgene plasmid # 68422 ; http://n2t.net/addgene:68422 ; RRID:Addgene_68422) -
For your References section:
Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Shechner DM, Hacisuleyman E, Younger ST, Rinn JL. Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1. 10.1038/nmeth.3433 PubMed 26030444