Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDNA_Lifeact-GFP_NLS-mCherry
(Plasmid #69058)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69058 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDNA 3.1 (+)
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 7751
  • Modifications to backbone
    insert of the cassette Lifeact-GFP_IRES_NLS-mCherry
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LifeAct-GFP_IRES_NLS-mCherry
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    720
  • Promoter CMV
  • Tag / Fusion Protein
    • Lifeact-GFP, NLS-mCherry

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGGCTCTCCTCAAGCGTATT
  • 3′ sequencing primer TTCAAAGGAAAACCACGTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The GFP sequence was cloned from the pEGFP-C1 plasmid The IRES sequence was cloned from the pIRES plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA_Lifeact-GFP_NLS-mCherry was a gift from Olivier Pertz (Addgene plasmid # 69058 ; http://n2t.net/addgene:69058 ; RRID:Addgene_69058)