pJW1328
(Plasmid
#69488)
-
PurposesgRNA(F+E) targeting pha-1 (no Cas9); for co-conversion in C. elegans
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69488 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCR-Blunt II-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3519
- Total vector size (bp) 4623
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA(F+E) targeting pha-1
-
gRNA/shRNA sequenceATGAATAACTTGATGAACAT
-
SpeciesC. elegans (nematode)
- Promoter R07E5.16 U6 promoter
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer pBR322-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW1328 was a gift from Jordan Ward (Addgene plasmid # 69488 ; http://n2t.net/addgene:69488 ; RRID:Addgene_69488)