Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pmtb-t7-alpha-bungarotoxin
(Plasmid #69542)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69542 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmtb
  • Backbone size w/o insert (bp) 6353
  • Total vector size (bp) 6641
  • Vector type
    Tol2, beta-actin promoter, sp6,t7 for zebrafish

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    alpha-bungarotoxin
  • Alt name
    btx
  • Species
    Synthetic
  • Insert Size (bp)
    288
  • GenBank ID
    KT279887
  • Promoter beta-actin, sp6, t7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggtcacatgcttgctgaaacgcc
  • 3′ sequencing primer GGT TTG TCC AAA CTC ATC AAT GTA TC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

For in vitro transcription, linearize with EcoRV, XmaI, SmaI, PmeI, or SphI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmtb-t7-alpha-bungarotoxin was a gift from Sean Megason (Addgene plasmid # 69542 ; http://n2t.net/addgene:69542 ; RRID:Addgene_69542)
  • For your References section:

    Improved Long-Term Imaging of Embryos with Genetically Encoded alpha-Bungarotoxin. Swinburne IA, Mosaliganti KR, Green AA, Megason SG. PLoS One. 2015 Aug 5;10(8):e0134005. doi: 10.1371/journal.pone.0134005. eCollection 2015. PONE-D-14-56074 [pii] PubMed 26244658